circad | circRNAs associated with diseases

hsa_circ_0001313 (circCCDC66)
Gene	CCDC66	Organism	Human
Genome Locus		Build	hg19
Disease	Colon Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink		PMID	30630646
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Radio-sensitive colon cancer tissue samples (n = 42) were collected from radiosensitive patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward GTATCTTGCCAGCTTTCTCCG Reverse TGCAGTTCTTGTTTCACAGC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Wang, L, Peng, X, Lu, X, Wei, Q, Chen, M, Liu, L (2019). Inhibition of hsa_circ_0001313 (circCCDC66) induction enhances the radio-sensitivity of colon cancer cells via tumor suppressor miR-338-3p: Effects of cicr_0001313 on colon cancer radio-sensitivity. Pathol. Res. Pract., 215, 4:689-696.